Northern blot analysis showed that rpmGC transcript was produced only in zur mutant strain. EMSA confirmed that Zur bound rpmGC promoter. rpmGC transcription start site was determined by 5'RACE.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AAATCGTAATTATTACGTTTTA | rpmG, |
|
repressor | not specified |