Curation Information

Publication
Regulation of the Bacillus subtilis yciC gene and insights into the DNA-binding specificity of the zinc-sensing metalloregulator Zur.;Gabriel SE, Miyagi F, Gaballa A, Helmann JD;Journal of bacteriology 2008 May; 190(10):3482-8 [18344368]
TF
Zur [P54479, view regulon]
Reported TF sp.
Bacillus subtilis subsp. subtilis str. 168
Reported site sp.
Bacillus subtilis subsp. subtilis str. 168
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Site directed mutagenesis in conjunction with beta-gal report assay demonstrated Zur-mediated regulation of yciC. EMSA was used to confirm binding.

Transcription Factor Binding Sites


AAATCGTAATCATTCTATTTT
AAGTCGTAACAATTACGTTTT
AAATCGTAATCATTCTATTTT
AAATCGTAACAATTACGTTTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
AAATCGTAATCATTCTATTTT yciC,
... ... yciC yczL yciB yciA nasA yckA yckB
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - repressor not specified
AAATCGTAACAATTACGTTTT yciC,
... ... yciC yciB yciA nasA yczL yckA yckB
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - repressor not specified