Iron responsive and Fur-regulated genes were identified by performing DNA microarray analysis. MEME-based analysis identified Fur binding motif. Fur-dependent expression was validated by β-galactosidase activity assays. Binding of Fur to its target promoter was confirmed by EMSA.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
ATTGCAATTCGTTCTCAAGTAAG | CCNA_03155, |
|
repressor | not specified |