Curation Information

Publication
Interaction of DevR with multiple binding sites synergistically activates divergent transcription of narK2-Rv1738 genes in Mycobacterium tuberculosis.;Chauhan S, Tyagi JS;Journal of bacteriology 2008 Aug; 190(15):5394-403 [18502855]
TF
DosR [I6XGD8, view regulon]
Reported TF sp.
Mycobacterium tuberculosis H37Rv
Reported site sp.
Mycobacterium tuberculosis H37Rv
Created by
Talmo Pereira
Curation notes
-

Experimental Process

Transcription start point mapped by primer extension assay. EMSA with phosphorylated DevR in intergenic region demonstrated binding. Confirmed via DNA pulldown (immuno-precipitation). DNAse I footprinting to specify binding regions, D1, D2, D3 boxes. Mutation at all boxes decreased binding as measured by DNAse footprinting. Promoter region fused with promoterless GFP and promoter activity was detected in hypoxic conditions through GFP reporter assay. Mutations at all three sites decreased promoter activity as measured by GFP reporter assay.

Transcription Factor Binding Sites


TTAGGGCCGGAAGTCCCCAA
TGGCGGACGAATGACCCCAG
GCCGGGACTTCAGGCCCTAT
TTAGGGCCGGAAGTCCCCAA
TGGCGGACGAATGACCCCAG
GCCGGGACTTCAGGCCCTAT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTAGGGCCGGAAGTCCCCAA RVBD_1738,
... ... RVBD_1738 RVBD_1737c RVBD_1739c RVBD_1736c
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Immuno-Precipitation - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer
TGGCGGACGAATGACCCCAG RVBD_1738,
... ... RVBD_1738 RVBD_1739c RVBD_1736c RVBD_1737c
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Immuno-Precipitation - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer
GCCGGGACTTCAGGCCCTAT RVBD_1738,
... ... RVBD_1738 RVBD_1736c RVBD_1737c RVBD_1739c
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Immuno-Precipitation - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer