Researchers used a B-Gal assay and primer extension assay to determine that AphA represses the OpaR promoter. They then used a DNase I assay to show that AphA protects a region within the OpaR promoter; furthermore, an EMSA of the OpaR promoter showed that in-vitro binding. The site described by the authors derives from the consensus site ATATGCA-N6-TGCATAT
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
ATATGCACCATTACACTCAT | VP2516, |
|
repressor | dimer |