Curation Information

Publication: Promoter specificity in Pseudomonas aeruginosa quorum sensing revealed by DNA binding of purified LasR.;Schuster M, Urbanowski ML, Greenberg EP;Proceedings of the National Academy of Sciences of the United States of America 2004 Nov 9; 101(45):15833-9 [15505212]
TF: LasR [P25084, view regulon]
Reported TF sp.: Pseudomonas aeruginosa PAO1
Reported site sp.: Pseudomonas aeruginosa PAO1
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

EMSA showed that LasR bound specifically to the las-rhl box in the lasI-rsaL intergenic region. DNase I footprinting showed that LasR protected a region that included the 20-bp las-rhl box.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

ATCTATCTCATTTGCTAGTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
ATCTATCTCATTTGCTAGTT			Experimental technique details DNAse footprinting (ECO:0005631) DNAse footprinting - ECO:0005631 The DNAse foot-printing method starts by focusing on a given region of interest (e.g. a promoter region) and amplifying it by PCR to obtain lots of sample. It then throws in the TF and then the DNAse. The mix is left to stir for a short time and then gel electrophoresis is run to compare the pattern of fragments in a control (no TF) and in the sample. If the TF has bound the sample, it will have protected a stretch of DNA (encompassing some fragments of the control) and thus those fragments will not appear in the sample gel. The fragments can then be cut-out from the gel, purified and sequenced to obtain the sequence of the protected region. This is often used to identify the binding motif of a TF for the first time. The foot-printing will typically resolve the protected region down to 50-100 bp, and the sequence can be then examined for possible TF-binding sites either by eye of using a computer search. - Experimental technique details EMSA (ECO:0001807) EMSA - ECO:0001807 Electro-mobility shift-assays (or gel retardation assays) are a standard way of assessing TF-binding. A fragment of DNA of interest is amplified and labeled with a fluorophore. The fragment is left to incubate in a solution containing abundant TF and non-specific DNA (e.g. randomly cleaved DNA from salmon sperm, of all things) and then a gel is run with the incubated sample and a control (sample that has not been in contact with the TF). If the TF has bound the sample, the complex will migrate more slowly than unbound DNA through the gel, and this retarded band can be used as evidence of binding. The unspecific DNA ensures that the binding is specific to the fragment of interest and that any non-specific DNA-binding proteins left-over in the TF purification will bind there, instead of on the fragment of interest. EMSAs are typically carried out in a bunch of fragments, shown as multiple double (control+experiment) lanes in a wide picture. Certain additional controls are run in at least one of the fragments to ascertain specificity. In the most basic of these, specific competitor (the fragment of interest or a known positive control, unlabelled) is added to the reaction. This should sequester the TF and hence make the retardation band disappear, proving that the binding is indeed specific -	activator	dimer