Curation Information

Publication
Identification of a gene involved in polysaccharide export as a transcription target of FruA, an essential factor for Myxococcus xanthus development.;Ueki T, Inouye S;The Journal of biological chemistry 2005 Sep 16; 280(37):32279-84 [16040607]
TF
FruA [Q1D7Q3, view regulon]
Reported TF sp.
Myxococcus xanthus DZF1
Reported site sp.
Myxococcus xanthus DZF1
Created by
Erill Lab
Curation notes
-

Experimental Process

Binding by genomic selex with tagged FruA. DNAse footprint confirms two bands. Beta-gal shows induction in specific dev phase dependent on FruA.

Transcription Factor Binding Sites


CACGCGCTGCTAAGGCAACGCCGCC
CACGCGCTGCTAAGGCAACGCCGCC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type