Site binding verified by EMSA with HgtR. Electron source-dependent expression verified by primer extension. Sites verified with MSA with known gltA site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type | 
|---|---|---|---|---|---|
| AAATTGTATACAGTATACTAAA | gltA, |  | repressor | not specified | |
| GATTTGTATACTGTATACAAAA | atpG, |  | repressor | not specified | |
| AAATTGTATACAGTATACGCAA | nuoA-1, |  | repressor | not specified | |
| TCCCTGTATACTGTATACAATA | GSU3370, |  | repressor | not specified |