Curation Information

Publication
RsaL provides quorum sensing homeostasis and functions as a global regulator of gene expression in Pseudomonas aeruginosa.;Rampioni G, Schuster M, Greenberg EP, Bertani I, Grasso M, Venturi V, Zennaro E, Leoni L;Molecular microbiology 2007 Dec; 66(6):1557-65 [18045385]
TF
LasR [P25084, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Erill Lab
Curation notes
-

Experimental Process

DNAse footprinting followed by EMSA was used to confirm binding of LasR simultaneously with RsaL.

Transcription Factor Binding Sites


TAACTAGCAAATGAGATAGATT
TAACTAGCAAATGAGATAGATT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TAACTAGCAAATGAGATAGATT
... ... rsaL lasR lasI PA1433 PA1434
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - repressor dimer