Curation Information

Publication: Mapping the regulon of Vibrio cholerae ferric uptake regulator expands its known network of gene regulation.;Davies BW, Bogard RW, Mekalanos JJ;Proceedings of the National Academy of Sciences of the United States of America 2011 Jul 26; 108(30):12467-72 [21750152]
TF: Fur [P0C6C8, view regulon]
Reported TF sp.: Vibrio cholerae El Tor biotype strain C6706 (948564)
Reported site sp.: Vibrio cholerae El Tor biotype strain C6706 (948564)
Created by: Erill Lab
Curation notes: -

Experimental Process

ChIP-Seq + MEME validation with ChIP-PCR Expression data curated from previous source. Details of ChIP-seq: "We compared the peak lists generated from all three samples and required that a peak be called in at least two of the three experiments to be considered a vcFur-binding site (Table S1). The average ChIP peak length was ∼500 bp."

ChIP assay conditions: VchFur: Vibrio cholerae El Tor biotype strain C6706 and a spontaneous lacZ− derivative of C6706 were used as parental (WT) strains. Fiftymilliliters ofexponentiallygrowing cultureinLB+ 40μM FeSO4 were induced with 0.1% arabinose for 30 min at 37° C.
ChIP notes: Formaldehyde was added to a ﬁnal concentration of 1% and incubated at RT for 20 min with occasional swirling. Crosslinking was quenched by adding glycine to 0.5M. Cell pellets were washed in 1× TBS and resuspended in lysis buffer [10 mM Tris (pH 8.0), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% deoxycholate (DOC), 0.5% N-lauroylsarcosine] plus protease inhibitor mixture (Sigma) and 1 mg/mL lysozyme and were incubated at 37° C for 30 min. The cells were sonicated 1×for 30 s with a needle sonicator, and unlysed debris was pelleted by centrifugation. The lysate was sonicated for 20 min with a 10-s on/10-s off cycle (Mixsonix). A sample was taken as a sequencing input control. Following clariﬁcation by centrifugation, 1/10 volume of 10% Triton X-100 in lysis buffer was added to each sample followed by 100 μL of Dynal-Protein G beads coated with anti-V5 monoclonal antibody (Sigma), and samples were incubated overnight with rotation. The beads were washed 5× with RIPA buffer [50 mM Hepes (pH7.5), 500 mM LiCl, 1 mM EDTA, 1% Nonidet P-40, 0.7% DOC] and then 1× in Tris-EDTA pH 8.0 plus 50 mM NaCl and were resuspended in 100μL elution buffer [50 mM Tris-HCl (pH 7.5), 10 mM EDTA, 1% SDS]. Samples were incubated at 65° C for 30 min, and the beads were pelleted by centrifugation. Supernatants were incubated at 65° C overnight to reverse crosslinks. Samples were incubated with 8 μL of 10-mg/mL RNase A for 2 h at 37° C and then with 4μL of 20 mg/mL proteinase K at 55° C for 2 h and were puriﬁed with Qiagen MinElute Reaction Cleanup Kit and quantitated with Pico green kit (Invitrogen). Experiments were performed in triplicate. One to three nanograms of ChIP or input DNA was processed for sequencing by the addition of a polyA tail as described by Helicos protocols (http://www.helicosbio.com/). Samples were sequenced using the HeliScope Single Molecule Sequencer at the Molecular Biology Core Facility in the Dana-Farber Cancer Institute, Boston, MA. The sequence reads were aligned to th

Transcription Factor Binding Sites

TTAATAATAGCAATTATCAAT
GACATGATTTTTATTCTCATG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TTAATAATAGCAATTATCAAT	VCA0910,		Experimental technique details ChIP-PCR (ECO:0005620) ChIP-PCR - ECO:0005620 ChIP-chip (and to a lesser degree ChIP-Seq) results are often validated with ChIP-PCR, in which a PCR with specific primers is performed on the pulled-down DNA. As in the case of RNASeq, there are many variations of these main techniques. - Experimental technique details ChIP-Seq (ECO:0006009) ChIP-Seq - ECO:0006009 ChIP-Seq is equivalent to ChIP-chip down to the last step. In ChIP-Seq, immunoprecipiated DNA fragments are prepared for sequencing and funneled into a massively parallel sequencer that produces short reads. Even though the sonication step is the same as in ChIP-chip, ChIP-Seq will generate multiple short-reads within any given 500 bp region, thereby pinning down the location of TFBS to within 50-100 bp. A similar result can be obtained with ChIP-chip using high-density tiling-arrays. The downside of ChIP-Seq is that sensitivity is proportional to cost, as sensitivity increases with the number of (expensive) parallel sequencing runs. To control for biases, ChIP-seq experiments often use the "input" as a control. This is DNA sequence resulting from the same pipeline as the ChIP-seq experiment, but omitting the immunoprecipitation step. It therefore should have the same accessibility and sequencing biases as the experiment data. - Experimental technique details Motif-discovery (ECO:0005558) Motif-discovery - ECO:0005558 In motif discovery, we are given a set of sequences that we suspect harbor binding sites for a given transcription factor. A typical scenario is data coming from expression experiments, in which we wish to analyze the promoter region of a bunch of genes that are up- or down-regulated under some condition. The goal of motif discovery is to detect the transcription factor binding motif (i.e. the sequence “pattern” bound by the TF), by assuming that it will be overrepresented in our sample of sequences. There are different strategies to accomplish this, but the standard approach uses expectation maximization (EM) and in particular Gibbs sampling or greedy search. Popular algorithms for motif discovery are MEME, Gibbs Motif Sampler or CONSENSUS. More recently, motif discovery algorithms that make use of phylogenetic foot-printing (the idea that TF-binding site will be conserved in the promoter sequences for the same gene in different species) have become available. These are not usually applied to complement experimental work, but can be used to provide a starting point for it. Popular algorithms include FootPrinter and PhyloGibbs. -	repressor	dimer
GACATGATTTTTATTCTCATG	VCA1098,		Experimental technique details ChIP-PCR (ECO:0005620) ChIP-PCR - ECO:0005620 ChIP-chip (and to a lesser degree ChIP-Seq) results are often validated with ChIP-PCR, in which a PCR with specific primers is performed on the pulled-down DNA. As in the case of RNASeq, there are many variations of these main techniques. - Experimental technique details ChIP-Seq (ECO:0006009) ChIP-Seq - ECO:0006009 ChIP-Seq is equivalent to ChIP-chip down to the last step. In ChIP-Seq, immunoprecipiated DNA fragments are prepared for sequencing and funneled into a massively parallel sequencer that produces short reads. Even though the sonication step is the same as in ChIP-chip, ChIP-Seq will generate multiple short-reads within any given 500 bp region, thereby pinning down the location of TFBS to within 50-100 bp. A similar result can be obtained with ChIP-chip using high-density tiling-arrays. The downside of ChIP-Seq is that sensitivity is proportional to cost, as sensitivity increases with the number of (expensive) parallel sequencing runs. To control for biases, ChIP-seq experiments often use the "input" as a control. This is DNA sequence resulting from the same pipeline as the ChIP-seq experiment, but omitting the immunoprecipitation step. It therefore should have the same accessibility and sequencing biases as the experiment data. - Experimental technique details Motif-discovery (ECO:0005558) Motif-discovery - ECO:0005558 In motif discovery, we are given a set of sequences that we suspect harbor binding sites for a given transcription factor. A typical scenario is data coming from expression experiments, in which we wish to analyze the promoter region of a bunch of genes that are up- or down-regulated under some condition. The goal of motif discovery is to detect the transcription factor binding motif (i.e. the sequence “pattern” bound by the TF), by assuming that it will be overrepresented in our sample of sequences. There are different strategies to accomplish this, but the standard approach uses expectation maximization (EM) and in particular Gibbs sampling or greedy search. Popular algorithms for motif discovery are MEME, Gibbs Motif Sampler or CONSENSUS. More recently, motif discovery algorithms that make use of phylogenetic foot-printing (the idea that TF-binding site will be conserved in the promoter sequences for the same gene in different species) have become available. These are not usually applied to complement experimental work, but can be used to provide a starting point for it. Popular algorithms include FootPrinter and PhyloGibbs. -	repressor	dimer