Curation Information

Publication
Dissecting the PhoP regulatory network of Escherichia coli and Salmonella enterica.;Zwir I, Shin D, Kato A, Nishino K, Latifi T, Solomon F, Hare JM, Huang H, Groisman EA;Proceedings of the National Academy of Sciences of the United States of America 2005 Feb 22; 102(8):2862-7 [15703297]
TF
PhoP [P23836, view regulon]
Reported TF sp.
Escherichia coli str. K-12 substr. MG1655
Reported site sp.
Escherichia coli str. K-12 substr. MG1655
Created by
Erill Lab
Curation notes
-

Experimental Process

Activated genes identified with DNA-array on low Mg2+ induction. Binding sites predicted with machine learning method based on submotif PSSM. Binding of PhoP validated with DNAse footprint and PhoP mediated regulation further verified by Beta-gal assay with w-t PhoP mutant.

Transcription Factor Binding Sites


TTATAAACATAAGCTATACGCTG
CCATCAACATGACATATACAGAA
TTATAAACATAAGCTATACGCTG
CCATCAACATGACATATACAGAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTATAAACATAAGCTATACGCTG gadY,
... ... gadY gadX gadW
Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - activator dimer
CCATCAACATGACATATACAGAA hdeA,
... ... hdeA hdeD dctR yhiD hdeB
Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - activator dimer