Activated genes identified with DNA-array on low Mg2+ induction. Binding sites predicted with machine learning method based on submotif PSSM. Binding of PhoP validated with DNAse footprint and PhoP mediated regulation further verified by Beta-gal assay with w-t PhoP mutant.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TTATAAACATAAGCTATACGCTG | gadY, |
|
activator | dimer | |
CCATCAACATGACATATACAGAA | hdeA, |
|
activator | dimer |