Curation Information

Publication
Transcription and regulation of the bidirectional hydrogenase in the cyanobacterium Nostoc sp. strain PCC 7120.;Sjöholm J, Oliveira P, Lindblad P;Applied and environmental microbiology 2007 Sep; 73(17):5435-46 [17630298]
TF
LexA [Q8YMM5, view regulon]
Reported TF sp.
Nostoc sp. PCC 7120
Reported site sp.
Nostoc sp. PCC 7120
Created by
Erill Lab
Curation notes
-

Experimental Process

EMSA to validate binding of LexA to broad region.

Transcription Factor Binding Sites


CATCTGGTTTAAATGGTTACACTTTAACTCACGAACCTACCATTGATACCCTCC
GCAGAAATATAGGGGCTAGGAGTTGAGGGTACTCTGGTTCGTCAAGCATTTGGGATGATT
CATCTGGTTTAAATGGTTACACTTTAACTCACGAACCTACCATTGATACCCTCC
GCAGAAATATAGGGGCTAGGAGTTGAGGGTACTCTGGTTCGTCAAGCATTTGGGATGATT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type