Binding of LexA first identified with EMSA on crude extract plus 2D-PAGE and MALDI-TOF, then validated with purified LexA and a single oligo for EMSA. Luciferase assay with overlapping oligo indicates that high expression of the gene is dependent on the same region containing the putative LexA-binding site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AACAACACCCAGAACCTAGTAACTAGTTCGACTTACCCTCCTTTCTTCG | MYO_115360, |
|
activator | dimer |