Curation Information

Publication
LexA, a transcription regulator binding in the promoter region of the bidirectional hydrogenase in the cyanobacterium Synechocystis sp. PCC 6803.;Oliveira P, Lindblad P;FEMS microbiology letters 2005 Oct 1; 251(1):59-66 [16102913]
TF
LexA [P73722, view regulon]
Reported TF sp.
Synechocystis sp. PCC 6803
Reported site sp.
Synechocystis sp. PCC 6803
Created by
Erill Lab
Curation notes
-

Experimental Process

hoxE determined to form operon via RT-PCR. LexA identified as binding via affinity assays and mass spec. Validation of binding with EMSA with multiple sized fragments.

Transcription Factor Binding Sites


AAGACAACCGGCAGCACTACAACAACGAATGCGAATTTTTGTTTGTTTCTCACGGCTTTTGGTGGCAATTTCCTTTAATTCTTTAATGTCCATGGGGTTTAAGCTCAATAACAACAAATCAAAAAATCAACTAGAAAAGAT
AAGACAACCGGCAGCACTACAACAACGAATGCGAATTTTTGTTTGTTTCTCACGGCTTTTGGTGGCAATTTCCTTTAATTCTTTAATGTCCATGGGGTTTAAGCTCAATAACAACAAATCAAAAAATCAACTAGAAAAGAT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type