Curation Information

Publication
A cyanobacterial AbrB-like protein affects the apparent photosynthetic affinity for CO2 by modulating low-CO2-induced gene expression.;Lieman-Hurwitz J, Haimovich M, Shalev-Malul G, Ishii A, Hihara Y, Gaathon A, Lebendiker M, Kaplan A;Environmental microbiology 2009 Apr; 11(4):927-36 [19077009]
TF
LexA [P73722, view regulon]
Reported TF sp.
Synechocystis sp. PCC 6803
Reported site sp.
Synechocystis sp. PCC 6803
Created by
Erill Lab
Curation notes
-

Experimental Process

EMSA to validate binding after crude extract of proteins bound at given condition. 2D-PAGE to identify proteins that bind.

Transcription Factor Binding Sites


GGTCACCATCTAGTCCCCAAAAAGCTGGCGATCGCCAAATAATAGTAAAACTTATCATTCAAATTTAAAATTACTTAGCAGATCCAGGGGGACAACTGCAAAATTGGTCGGATTTACATATAGACTTTAGCTTATAGATTTCAAGACATAGGCATTCAAACCTG
GGTCACCATCTAGTCCCCAAAAAGCTGGCGATCGCCAAATAATAGTAAAACTTATCATTCAAATTTAAAATTACTTAGCAGATCCAGGGGGACAACTGCAAAATTGGTCGGATTTACATATAGACTTTAGCTTATAGATTTCAAGACATAGGCATTCAAACCTG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type