Curation Information

Publication
A LexA-related protein regulates redox-sensitive expression of the cyanobacterial RNA helicase, crhR.;Patterson-Fortin LM, Colvin KR, Owttrim GW;Nucleic acids research 2006; 34(12):3446-54 [16840531]
TF
LexA [P73722, view regulon]
Reported TF sp.
Synechocystis sp. PCC 6803
Reported site sp.
Synechocystis sp. PCC 6803
Created by
Erill Lab
Curation notes
they report motif similar to cyano LexA, but not support it experimentally. This has been later revised PMID: 18555801

Experimental Process

Site identified through promoter deletion series coupled to EMSA. Differential expression of lexA and crhR shown by Northern blot. Verification of repression by in-vitro transcription.

Transcription Factor Binding Sites


ATGACTAATACTTTGACTAGTACCTTCGCTGACCTTGGTC
ATGACTAATACTTTGACTAGTACCTTCGCTGACCTTGGTC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type