Curation Information

Publication
Competitive and cooperative effects in quorum-sensing-regulated galactoglucan biosynthesis in Sinorhizobium meliloti.;McIntosh M, Krol E, Becker A;Journal of bacteriology 2008 Aug; 190(15):5308-17 [18515420]
TF
ExpR [Q92L12, view regulon]
Reported TF sp.
Sinorhizobium meliloti 1021
Reported site sp.
Sinorhizobium meliloti 1021
Created by
Erill Lab
Curation notes
-

Experimental Process

Use of EMSA to validate binding.

Transcription Factor Binding Sites


CCGTCCCCCAAACTCTTGGGGGTTATTAAAACT
CCCCTCATCGTCATTATCCTGCTCTATATGTTCG
CCGTCCCCCAAACTCTTGGGGGTTATTAAAACT
CCCCTCATCGTCATTATCCTGCTCTATATGTTCG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type