Curation Information

Publication
Mechanism for iron-regulated transcription of the Escherichia coli cir gene: metal-dependent binding of fur protein to the promoters.;Griggs DW, Konisky J;Journal of bacteriology 1989 Feb; 171(2):1048-54 [2644221]
TF
Fur [P0A9A9, view regulon]
Reported TF sp.
Escherichia coli str. K-12 substr. MG1655
Reported site sp.
Escherichia coli str. K-12 substr. MG1655
Created by
Urooq Aqeel
Curation notes
-

Experimental Process

First a B-gal assay was performed to confirm fur expression. Gel retardation assays were used to demonstrate binding of purified Fur protein to the iron control region. Finally a footprint analysis done using DNAse I, found the TF binding site.

Transcription Factor Binding Sites


AATTTAACATTTGGATTTATAATTGTTATCGTTTGCATTATCGTTAC
AATTTAACATTTGGATTGATAATTGTTATCGTTTGCATTATCGTTAC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type