Curation Information

Publication
Analysis of RovA, a transcriptional regulator of Yersinia pseudotuberculosis virulence that acts through antirepression and direct transcriptional activation.;Tran HJ, Heroven AK, Winkler L, Spreter T, Beatrix B, Dersch P;The Journal of biological chemistry 2005 Dec 23; 280(51):42423-32 [16257976]
TF
RovA [B1JJ73, view regulon]
Reported TF sp.
Yersinia pseudotuberculosis YP1
Reported site sp.
Yersinia pseudotuberculosis YP1
Created by
Erill Lab
Curation notes
regulator alternatively named SlyA or RovA. Confirmed by BLAST.

Experimental Process

In vitro transcription to demonstrate activator function of RovA. EMSA and footprinting on inv promoter. Reporter assay with phoA on inv promoter.

Transcription Factor Binding Sites


CAGCCATGAACATTCCACATATCAAAAAGATACAAATAACTATTCGTGAAATAATATTAAATGAAATTATTTTATTAAAATACATAGACATTCCCGCATTCCTTATCAAGAGAAACTCACTGATTGGCTGGAAAACCATCATAATTTAAATGAAATAAAGCATACCTGTCATACGTCAAACTGCATGTGCGTTGGCTGTGCTCAACAACTTGAGTTATTTGAGGTATAACTGGCCACAAACGAGCATTTGAAATCACCTTGACCATTAATTAAAGATGCAATAGTTGAAAGTGAAACTTGTTTTCTAATTTAGT
CAGCCATGAACATTCCACATATCAAAAAGATACAAATAACTATTCGTGAAATAATATTAAATGAAATTATTTTATTAAAATACATAGACATTCCCGCATTCCTTATCAAGAGAAACTCACTGATTGGCTGGAAAACCATCATAATTTAAATGAAATAAAGCATACCTGTCATACGTCAAACTGCATGTGCGTTGGCTGTGCTCAACAACTTGAGTTATTTGAGGTATAACTGGCCACAAACGAGCATTTGAAATCACCTTGACCATTAATTAAAGATGCAATAGTTGAAAGTGAAACTTGTTTTCTAATTTAGT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type