Curation Information

Publication
LexA cleavage is required for CTX prophage induction.;Quinones M, Kimsey HH, Waldor MK;Molecular cell 2005 Jan 21; 17(2):291-300 [15664197]
TF
LexA [Q9KVP9, view regulon]
Reported TF sp.
Vibrio cholerae O1 biovar El Tor str. N16961
Reported site sp.
Vibrio cholerae O1 biovar El Tor str. N16961
Created by
Kathryn Cronise
Curation notes
-

Experimental Process

A beta-gal assay was used to verify expression and EMSA and DNase footprinting were used to verify binding.

Transcription Factor Binding Sites


GGCTGTTTTTTTGTACATTA
GGCTGTTTTTTTGTACATTA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GGCTGTTTTTTTGTACATTA VC1454,
... ... VC1454 VC1453 VC1455
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - repressor dimer