A PSSM search was performed with known phhA sites and the consensus for PhhR. Isothermal titration calorimetry (ITC) was used to show that binding is favorable.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
CACAAGTGATACACGATTGACGACCA |
|
repressor | dimer |