A consensus search identified rhlI as a gene potentially regulated by AlgR. A beta-gal assay showed that AlgR represses rhlI. EMSA was used to show binding. Mutagenesis followed by EMSA was used to show that the binding is specific.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GCCTGCCGTTCATCCTCCTT | rhlI, |
|
repressor | not specified |