Curation Information

Publication
The gonococcal fur regulon: identification of additional genes involved in major catabolic, recombination, and secretory pathways.;Sebastian S, Agarwal S, Murphy JR, Genco CA;Journal of bacteriology 2002 Jul; 184(14):3965-74 [12081969]
TF
Fur [Q5F5Y9, view regulon]
Reported TF sp.
Neisseria gonorrhoeae FA 1090
Reported site sp.
Neisseria gonorrhoeae FA 1090
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

fbpA Fur-binding sequence was used to identify putative Fur-binding sites in N. gonorrhoeae genome. Binding of the gonococcal Fur protein to the promoter regions of the identified genes was verified by EMSA.

Transcription Factor Binding Sites


GAGATCTTAAGAAACGTCTTT
TATAATAGAAGATTGCAATTT
GAGATCTTAAGAAACGTCTTT
TATAATAGAAGATTGCAATTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GAGATCTTAAGAAACGTCTTT
... ... secY infA rplO rpmD rpsE rplR rplF rpsH rpsN rplE rplX rplN
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer
TATAATAGAAGATTGCAATTT
... ... NGO0449 NGO0451
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer