A microarray analysis identified rhlA as a gene that is differentially regulated by AlgR. A beta-gal assay confirmed that AlgR represses rhlA. EMSA was used to show binding. Mutagenesis followed by EMSA was used to show that one of the two putative sites is required for binding.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TCGAGCCGTTCGTCGAGCGC | rhlA, |
|
repressor | not specified |