A beta-gal assay was used to show that the CRP-binding consensus sequence (CCS) is necessary for lasR expression. A beta-gal assay also showed that Vfr is necessary for lasR transcription. EMSA was used to show Vfr binding. Site-directed mutagenesis was performed within the CCS, followed by EMSA, to show that the CCS is necessary for Vfr binding.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AAATGTGATCTAGATCACATTT | lasR, |
|
activator | not specified |