Curation Information

Publication
Vfr controls quorum sensing in Pseudomonas aeruginosa.;Albus AM, Pesci EC, Runyen-Janecky LJ, West SE, Iglewski BH;Journal of bacteriology 1997 Jun; 179(12):3928-35 [9190808]
TF
Vfr [P55222, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Kathryn Cronise
Curation notes
-

Experimental Process

A beta-gal assay was used to show that the CRP-binding consensus sequence (CCS) is necessary for lasR expression. A beta-gal assay also showed that Vfr is necessary for lasR transcription. EMSA was used to show Vfr binding. Site-directed mutagenesis was performed within the CCS, followed by EMSA, to show that the CCS is necessary for Vfr binding.

Transcription Factor Binding Sites


AAATGTGATCTAGATCACATTT
AAATGTGATCTAGATCACATTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
AAATGTGATCTAGATCACATTT lasR,
... ... lasR rsaL PA1429
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator not specified