Curation Information

Publication
Autoregulation of Helicobacter pylori Fur revealed by functional analysis of the iron-binding site.;Delany I, Spohn G, Pacheco AB, Ieva R, Alaimo C, Rappuoli R, Scarlato V;Molecular microbiology 2002 Nov; 46(4):1107-22 [12421315]
TF
Fur [B5Z6G7, view regulon]
Reported TF sp.
Helicobacter pylori G27
Reported site sp.
Helicobacter pylori G27
Created by
Urooq Aqeel
Curation notes
-

Experimental Process

Site directed mutagenesis of fur performed to confirm the location of fur site then primer extension was performed, then DNAse Footprinting was performed to find the binding motif for fur, and finally a Western blot analysis was performed to confirm gene expression.

Transcription Factor Binding Sites


TTCCAAAGTTTCTAATCTTTTC
TTCCAAAGTTTCTAATCTTTTC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTCCAAAGTTTCTAATCTTTTC HPG27_401,
... ... HPG27_401 fliY-1 HPG27_399 HPG27_400 fliM HPG27_402 HPG27_403 HPG27_404
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - activator dimer