Site directed mutagenesis of fur performed to confirm the location of fur site then primer extension was performed, then DNAse Footprinting was performed to find the binding motif for fur, and finally a Western blot analysis was performed to confirm gene expression.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TTCCAAAGTTTCTAATCTTTTC | HPG27_401, |
|
activator | dimer |