Curation Information

Publication
Regulation of the Salmonella typhimurium pepT gene by cyclic AMP receptor protein (CRP) and FNR acting at a hybrid CRP-FNR site.;Lombardo MJ, Lee AA, Knox TM, Miller CG;Journal of bacteriology 1997 Mar; 179(6):1909-17 [9068635]
TF
CRP [P0A2T8, view regulon]
Reported TF sp.
Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
Reported site sp.
Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
Created by
Patrick O'Neill
Curation notes
-

Experimental Process

(1) Determination of binding by primer exension assay. (2) Determination of regulation by beta-gal assay. Site-directed mutagenesis of weak -10 promoter to consensus sequence allows transcription in absence of FNR.

Transcription Factor Binding Sites


AAAAGTGACCTGACGCAATATTTGTCTTTTCTTGCTTATT
AAAAGTGACCTGACGCAATATTTGTCTTTTCTTGCTTATT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
AAAAGTGACCTGACGCAATATTTGTCTTTTCTTGCTTATT pepT,
... ... pepT potA potB STM1228 ycfD
Experimental technique details Beta-gal reporter assay - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer