Experimenters used EMSAs and DNase protection assays to demonstrate binding, and used comparisons between the primer extension assays of wt and ∆OpaR to determine regulatory impact
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GACTAACTCAATTGTTAATA |
|
activator | dimer | ||
TGTTTATTAATCAATCATTA |
|
activator | dimer | ||
TGCTGAGAAAGTGATTAGTA |
|
activator | dimer |