Researchers used LacZ fusions (in E. Coli) to determine the regulatory impact of LuxR on the putative lux boxes. They then ran EMSA's with those that showed a change in regulation.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
ACCTGTAGGATCGTACAGGT | VFMJ11_A1042, |
|
activator | dimer |