Curation Information

Publication
Identification of operator sites within the upstream region of the putative mce2R gene from mycobacteria.;Vindal V, Ashwantha Kumar E, Ranjan A;FEBS letters 2008 Apr 2; 582(7):1117-22 [18329386]
TF
Mce2R [P9WMG5, view regulon]
Reported TF sp.
Mycobacterium tuberculosis H37Rv
Reported site sp.
Mycobacterium avium subsp. paratuberculosis K-10
Created by
Robert Forder
Curation notes
-

Experimental Process

Putative binding sites in the mce2 operon promoter region were detected by MSA, then verified with EMSA. They use M. tuberculosis protein to test against orthologous promoters in other Mycobacteria

Transcription Factor Binding Sites


GCCGGTGGTCTGACCACCTGA
GCCGGTGGTCTGACCACCTGA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GCCGGTGGTCTGACCACCTGA
... ... MAP4080c MAP4081 MAP4082 MAP4083
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - not specified not specified