Curation Information

Publication
The MatP/matS site-specific system organizes the terminus region of the E. coli chromosome into a macrodomain.;Mercier R, Petit MA, Schbath S, Robin S, El Karoui M, Boccard F, Espéli O;Cell 2008 Oct 31; 135(3):475-85 [18984159]
TF
MatP [P0A8N0, view regulon]
Reported TF sp.
Escherichia coli str. K-12 substr. MG1655
Reported site sp.
Escherichia coli str. K-12 substr. MG1655
Created by
Erill Lab
Curation notes
-

Experimental Process

Statistical prediction of overrepresented words in Ter region. Identification of bound protein through EMSA. Purification and validation of binding to specific site with EMSA.

Transcription Factor Binding Sites


TGATGTTACCAACAATGAAAGTGACACTGTCACCTTTTACCGTACTGCCGTCT
GCAAAAACACGGCCTGCGCTGTGCCATTGTCACTCGTGGTCAAAGCGCACTGC
TGATGTTACCAACAATGAAAGTGACACTGTCACCTTTTACCGTACTGCCGTCT
GCAAAAACACGGCCTGCGCTGTGCCATTGTCACTCGTGGTCAAAGCGCACTGC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TGATGTTACCAACAATGAAAGTGACACTGTCACCTTTTACCGTACTGCCGTCT
... ... valW valV mdtK ydhQ
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCAAAAACACGGCCTGCGCTGTGCCATTGTCACTCGTGGTCAAAGCGCACTGC
... ... glpB glpA glpC
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer