Curation Information

Publication: The Escherichia coli K-12 MntR miniregulon includes dps, which encodes the major stationary-phase DNA-binding protein.;Yamamoto K, Ishihama A, Busby SJ, Grainger DC;Journal of bacteriology 2011 Mar; 193(6):1477-80 [21239586]
TF: MntR [P0A9F1, view regulon]
Reported TF sp.: Escherichia coli strain BW25113
Reported site sp.: Escherichia coli strain BW25113
Created by: Erill Lab
Curation notes: -

Experimental Process

Beta-gal assays used to confirm induction on ChIP-chip binding data for a single gene (dps).

The paper reports that TF forms complex with other proteins for binding with reported sites.

Interaction with Fis and OxyR using expression analysis.

ChIP assay conditions: MntR: Strain BW25113 (6) was grown aerobically in LB medium supplemented with either 0.2 mM MnCl2 (to stimulate DNA binding by MntR) or 0.1 mM EDTA (as a negative control).
ChIP notes: At an optical density at 650 nm (OD650) of 0.3 to 0.4, cells were treated with formaldehyde, and cellular DNA was extracted and sonicated, yielding DNA fragments of 500 to 1,000 bp. After immunoprecipitation with anti-MntR antibodies, DNA fragments from MnCl2 or control EDTA-treated cells were purified and labeled with Cy5 and Cy3, respectively. The two DNA samples were then mixed and hybridized to the 43,450-feature DNA microarray (Oxford Gene Technology, Oxford, United Kingdom). After washing and scanning, the Cy5/Cy3 signal intensity ratio was calculated for each probe. The experiment was done in duplicate, and an average of the two Cy5/Cy3 ratios was used for further analysis.

Transcription Factor Binding Sites

ATTAAGTATAGCACCGGCTATGTGTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
ATTAAGTATAGCACCGGCTATGTGTT	dps,		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details ChIP-chip (ECO:0006007) ChIP-chip - ECO:0006007 The principle of ChIP-chip is simple. The first step is to cross-link the protein-DNA complex. This is done using a fixating agent, such as formaldehyde. The cross-linking can later be reversed with heat. Cross-linking kills the cell, giving a snapshot of the bound TF at a given time. The cell is then lysed, the DNA sheared by sonication and the chromatin[2] (TF-DNA complexes) is pulled down using an antibody (i.e. immunoprecipitated). If an antibody for the TF is available, then it is used; otherwise, the TF is tagged with an epitope targeted by commercially available antibodies (the latter option is cheaper, but runs the risk of altering the TF's functionality). Cross-linking is then reversed to free the bound DNA, which is then amplified, labeled with a fluorophore and dumped onto a DNA-array. The scanned array reveals the genomic regions bound by the TF. The resolution is around ~500 bp as a result of the sonication step. -	repressor	dimer