Putative binding sites in the mce2 operon promoter region were detected by MSA, then verified with EMSA. They use M. tuberculosis protein to test against orthologous promoters in other Mycobacteria
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GGTGTCGGTCTGACCACTTGA |
|
not specified | not specified |