The regulatory effect of CueR on copA was established via beta-gal assays using a CueR knockout and the wild-type. Binding of CueR to the copA promoter was establihed with EMSA using purified CueR protein, and the effect of Cu on binding affinity was also established. DNA footprinting on the copA promoter defined the palindromic binding site of CueR.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type | 
|---|---|---|---|---|---|
| ACCTTCCCCTTGCTGGAAGGT | copA, |  | activator | not specified |