Curation Information

Publication
CueR (YbbI) of Escherichia coli is a MerR family regulator controlling expression of the copper exporter CopA.;Stoyanov JV, Hobman JL, Brown NL;Molecular microbiology 2001 Jan; 39(2):502-11 [11136469]
TF
CueR [P0A9G4, view regulon]
Reported TF sp.
Escherichia coli str. K-12 substr. MG1655
Reported site sp.
Escherichia coli str. K-12 substr. MG1655
Created by
Erill Lab
Curation notes
-

Experimental Process

The regulatory effect of CueR on copA was established via beta-gal assays using a CueR knockout and the wild-type. Binding of CueR to the copA promoter was establihed with EMSA using purified CueR protein, and the effect of Cu on binding affinity was also established. DNA footprinting on the copA promoter defined the palindromic binding site of CueR.

Transcription Factor Binding Sites


ACCTTCCCCTTGCTGGAAGGT
ACCTTCCCCTTGCTGGAAGGT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
ACCTTCCCCTTGCTGGAAGGT copA,
... ... copA ybaS ybaT cueR
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - activator not specified