Various lengths of xpsR promoter fragment were tested for activity with beta-gal assays using a vsrD mutant. Mutations were introduced to the putative binding site, determined by visual inspection and tested with beta-gal assays. EMSAs with w-t and mutated-site fragments confirmed VsrD binding.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AATCCCCTCTAAATTGGGGATT | RS_RS21960, |
|
activator | not specified |