Curation Information

Publication: Identification of novel Ralstonia solanacearum type III effector proteins through translocation analysis of hrpB-regulated gene products.;Mukaihara T, Tamura N;Microbiology (Reading, England) 2009 Jul; 155(Pt 7):2235-44 [19406897]
TF: HrpB [P31778, view regulon]
Reported TF sp.: Ralstonia solanacearum GMI1000
Reported site sp.: Ralstonia solanacearum GMI1000
Created by: Erill Lab
Curation notes: -

Experimental Process

To determine whether candidate effector genes were regulated by hrpB the expression level of the Cya fusion protein between the constitutive-hrpB and delta-hrpB strains was compared through an in vitro adenylate cyclase activity assay.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TTCGCCCCCGGCCCCATCCATTCG
TTCGGCTCCGGCCTCATCACTTCG
TTCGCTTTTGGATGCGGCGCTTCG
TTCGCCCATGGAACCGGCGCTTCG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Experimental techniques	TF function	TF type
TTCGCCCCCGGCCCCATCCATTCG	RS_RS22570,	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details Cya fusion reporter (ECO:0006002) Cya fusion reporter - ECO:0006002 The calmodulin-dependent adenylate cyclase (Cya) domain of the cyclolysin toxin from Bordetella pertussis can be exploited as a reporter for translocation of effector proteins [PMID::10217833] [PMID::14702323]. Cya is not active in bacterial cytoplasm because bacteria do not possess calmodulin, and it is not naturally secreted or translocated by the type III secretion systems. However, when the N-terminal portion of an effector is fused to Cya, bacteria can deliver the resulting hybrid protein into the cytosol of host cells, where it can bind to calmodulin and produce cyclic AMP (cAMP) from ATP. Adenylate cyclase activity can also be assessed in vitro without translocation to a host. -	activator	not specified
TTCGGCTCCGGCCTCATCACTTCG	RS_RS21175,	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details Cya fusion reporter (ECO:0006002) Cya fusion reporter - ECO:0006002 The calmodulin-dependent adenylate cyclase (Cya) domain of the cyclolysin toxin from Bordetella pertussis can be exploited as a reporter for translocation of effector proteins [PMID::10217833] [PMID::14702323]. Cya is not active in bacterial cytoplasm because bacteria do not possess calmodulin, and it is not naturally secreted or translocated by the type III secretion systems. However, when the N-terminal portion of an effector is fused to Cya, bacteria can deliver the resulting hybrid protein into the cytosol of host cells, where it can bind to calmodulin and produce cyclic AMP (cAMP) from ATP. Adenylate cyclase activity can also be assessed in vitro without translocation to a host. -	activator	not specified
TTCGCTTTTGGATGCGGCGCTTCG	RS_RS21170	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details Cya fusion reporter (ECO:0006002) Cya fusion reporter - ECO:0006002 The calmodulin-dependent adenylate cyclase (Cya) domain of the cyclolysin toxin from Bordetella pertussis can be exploited as a reporter for translocation of effector proteins [PMID::10217833] [PMID::14702323]. Cya is not active in bacterial cytoplasm because bacteria do not possess calmodulin, and it is not naturally secreted or translocated by the type III secretion systems. However, when the N-terminal portion of an effector is fused to Cya, bacteria can deliver the resulting hybrid protein into the cytosol of host cells, where it can bind to calmodulin and produce cyclic AMP (cAMP) from ATP. Adenylate cyclase activity can also be assessed in vitro without translocation to a host. -	activator	not specified
TTCGCCCATGGAACCGGCGCTTCG	RS_RS18580,	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details Cya fusion reporter (ECO:0006002) Cya fusion reporter - ECO:0006002 The calmodulin-dependent adenylate cyclase (Cya) domain of the cyclolysin toxin from Bordetella pertussis can be exploited as a reporter for translocation of effector proteins [PMID::10217833] [PMID::14702323]. Cya is not active in bacterial cytoplasm because bacteria do not possess calmodulin, and it is not naturally secreted or translocated by the type III secretion systems. However, when the N-terminal portion of an effector is fused to Cya, bacteria can deliver the resulting hybrid protein into the cytosol of host cells, where it can bind to calmodulin and produce cyclic AMP (cAMP) from ATP. Adenylate cyclase activity can also be assessed in vitro without translocation to a host. -	activator	not specified