A putative MerR-like binding site was detected by visual inspection and MSA. A CsoR mutant was shown to induce copZA expression dependent on copper via beta-gal assays with w-t and csoR- mutants with and without adding CuSO4. The effect of CsoR on copZA was further assessed by analyzing tolerance for copper shock. EMSA was used to determine that CsoR is a copper-sensing repressor on the copZA promoter. DNAfootprinting was used to determine the specific binding site: TACCCTACGGGGGTATGGTA
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TACCCTACGGGGGTATGGTA | copZ, copA |
|
repressor | not specified |