Curation Information

Publication
CsoR regulates the copper efflux operon copZA in Bacillus subtilis.;Smaldone GT, Helmann JD;Microbiology (Reading, England) 2007 Dec; 153(Pt 12):4123-8 [18048925]
TF
CsoR [O32222, view regulon]
Reported TF sp.
Bacillus subtilis subsp. subtilis str. 168
Reported site sp.
Bacillus subtilis subsp. subtilis str. 168
Created by
Erill Lab
Curation notes
-

Experimental Process

A putative MerR-like binding site was detected by visual inspection and MSA. A CsoR mutant was shown to induce copZA expression dependent on copper via beta-gal assays with w-t and csoR- mutants with and without adding CuSO4. The effect of CsoR on copZA was further assessed by analyzing tolerance for copper shock. EMSA was used to determine that CsoR is a copper-sensing repressor on the copZA promoter. DNAfootprinting was used to determine the specific binding site: TACCCTACGGGGGTATGGTA

Transcription Factor Binding Sites


TACCCTACGGGGGTATGGTA
TACCCTACGGGGGTATGGTA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TACCCTACGGGGGTATGGTA copZ, copA
... ... copZ copA
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Visual sequence inspection (nan) - repressor not specified