The Helicobacter pylori HP1512 gene was identified as a gene of interest using a whole-genome microarray. Quantitative PCR measured transcription of HP1512 in nickel-variable cultures, and a nickel supplement of 10 uM resulted in a 43-fold decrease in transcription. A consensus search identified a putative binding site that was a perfect match to the operator consensus sequence, and EMSA demonstrated site-specific binding of NikR to the target site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TATTATTAAATAGAATAATGTAATAATA | HP1512 |
|
repressor | tetramer |