Curation Information

Publication
Target transcription binding sites differentiate two groups of MerR-monovalent metal ion sensors.;Pérez Audero ME, Podoroska BM, Ibáñez MM, Cauerhff A, Checa SK, Soncini FC;Molecular microbiology 2010 Nov; 78(4):853-65 [20807206]
TF
CueR [A0A0F6AXY2, view regulon]
Reported TF sp.
Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Reported site sp.
Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Created by
Elizabeth Cardosa
Curation notes
-

Experimental Process

The CueR promoter binding sites were determined from Salmonella and E.coli by DNase 1 footprinting. Affinity of CueR for the copA promoter was determined by EMSA. Binding of CueR to the copa promoter was also shown by DNase 1 footprinting. Western blot analysis showed expression of CueR in the presence of certain metals. MEME searches were performed to search for binding motifs.

Transcription Factor Binding Sites


GACCTTTCCCTTAGGGGAACCCCTAT
GACCTTAACCTTGCTGGAAGGTTTA
GACCTTTCCCTTAGGGGAACCCCTAT
GACCTTAACCTTGCTGGAAGGTTTA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GACCTTTCCCTTAGGGGAACCCCTAT STM14_4400
... ... STM14_4400
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - activator monomer
GACCTTAACCTTGCTGGAAGGTTTA cueR, copA
... ... cueR copA
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - activator monomer