RNA dot blots were used to identify a non-exhaustive series of genes whose expression was modified by nikR. Beta-gal assays confirmed the effects of nikR on these genes, including autoregulatory activity of the nikR gene (hp1338). EMSA demonstrated the affinity of nikR for the upstream region of its own gene, and a putative palindromic binding site was identified based on the binding site of the E. coli nikR homologue. Mutagenesis of this putative site, illustrated by beta-gal assays, abolished the autoregulatory effects of nikR.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GCATGAGTTCGTTAAAAGCCGCTCATGC | HP1338, |
|
repressor | tetramer |