Curation Information

Publication
Regulation of gbpC expression in Streptococcus mutans.;Biswas I, Drake L, Biswas S;Journal of bacteriology 2007 Sep; 189(18):6521-31 [17616585]
TF
CovR [I6L8Z5, view regulon]
Reported TF sp.
Streptococcus mutans UA159
Reported site sp.
Streptococcus mutans UA159
Created by
Joe Sparenberg
Curation notes
-

Experimental Process

Using GUS reporter gene assay, it was determined that CovR represses gbpC. Semiquantitative RT-PCR confirmed this result. EMSA verified that CovR binds to the promoter region of gbpC. DNase I footprinting discovered the binding site sequence.

Transcription Factor Binding Sites


GACATTATTTTTTAATTTATGAGTCTTATTCTTTGAAAAAATGTCTTTTTATTGTTATAATTAAAATTGTATTCTTATGAATTAATAATATAAAGG
GACATTATTTTTTAATTTATGAGTCTTATTCTTTGAAAAAATGTCTTTTTATTGTTATAATTAAAATTGTATTCTTATGAATTAATAATATAAAGG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type