In-vitro transcription showed the CovR directly inhibits transcription of sag. EMSA showed that CovR directly binds to sag at two places. DNase I footprinting protected an 80bp region and a 150bp region on sag. Both of these regions contain the consensus sequence of ATTARA.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AAGTTATAAAGCTTTAAAAATTAGCTCTCATTTTTGTCGTTATTGTTTGAAAAATATAGTTTTTTAGAGAAAATTATTATTTTTTTTGTCATTTTTGATAATATTAAAAAGAAAGGGTTTACATATTAATCATTTTTTACTATAATAAAAGTG | M6_Spy0578 |
|
repressor | not specified | |
TAACTTTATTTTTAAAATAAGGTTAAAAATAAACGACTCGTGTTCTTATCAGTTACTTATTAGATAAGGAGGTAAACCTTATG | M6_Spy0578, |
|
repressor | not specified |