Curation Information

Publication
H-NS-mediated repression of CRISPR-based immunity in Escherichia coli K12 can be relieved by the transcription activator LeuO.;Westra ER, Pul U, Heidrich N, Jore MM, Lundgren M, Stratmann T, Wurm R, Raine A, Mescher M, Van Heereveld L, Mastop M, Wagner EG, Schnetz K, Van Der Oost J, Wagner R, Brouns SJ;Molecular microbiology 2010 Sep; 77(6):1380-93 [20659289]
TF
LeuO [P10151, view regulon]
Reported TF sp.
Escherichia coli str. K-12 substr. MG1655
Reported site sp.
Escherichia coli str. K-12 substr. MG1655
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

EMSA determined that LeuO binds to casA-cas3 intergenic region. DNase I footprinting mapped LeuO binding sites in this region.

Transcription Factor Binding Sites


ATGAGATTTTATATTCACAGTATGAATATTTTATGTAATAAAATTCATGGTAATTATTA
ATGTATAGGTTAATTGTATTAAACCAATGAATATATTTTTGCAGTGAATGTGATTATT
ATGAGATTTTATATTCACAGTATGAATATTTTATGTAATAAAATTCATGGTAATTATTA
ATGTATAGGTTAATTGTATTAAACCAATGAATATATTTTTGCAGTGAATGTGATTATT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type