Curation Information

Publication
Threonine phosphorylation prevents promoter DNA binding of the Group B Streptococcus response regulator CovR.;Lin WJ, Walthers D, Connelly JE, Burnside K, Jewell KA, Kenney LJ, Rajagopal L;Molecular microbiology 2009 Mar; 71(6):1477-95 [19170889]
TF
CovR [I6L8Z5, view regulon]
Reported TF sp.
Streptococcus agalactiae A909
Reported site sp.
Streptococcus agalactiae A909
Created by
Joe Sparenberg
Curation notes
-

Experimental Process

qRT-PCR showed that CovR represses cylX among other genes. EMSA showed direct binding to cylX. DNase I footprinting discovered two sequences in cylX that CovR binds to. With a point mutation in each sequence, site directed mutagenesis decreased binding and a relief of repression.

Transcription Factor Binding Sites


AACATAATAATGATATTTTAATTAGAGTGTGAATTTATAATTAA
CTAATGTTT
AACATAATAATGATATTTTAATTAGAGTGTGAATTTATAATTAA
CTAATGTTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
AACATAATAATGATATTTTAATTAGAGTGTGAATTTATAATTAA cylX,
... ... cylX cylD cylG SAK_0793 cylZ cylA cylB cylE cylF cylI cylJ cylK
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - repressor not specified
CTAATGTTT cylX,
... ... cylX cylD cylG SAK_0793 cylZ cylA cylB cylE cylF cylI cylJ cylK
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - repressor not specified