qRT-PCR showed that CovR represses cylX among other genes. EMSA showed direct binding to cylX. DNase I footprinting discovered two sequences in cylX that CovR binds to. With a point mutation in each sequence, site directed mutagenesis decreased binding and a relief of repression.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AACATAATAATGATATTTTAATTAGAGTGTGAATTTATAATTAA | cylX, |
|
repressor | not specified | |
CTAATGTTT | cylX, |
|
repressor | not specified |