Curation Information

Publication
Unraveling the regulatory network in Streptococcus pyogenes: the global response regulator CovR represses rivR directly.;Roberts SA, Churchward GG, Scott JR;Journal of bacteriology 2007 Feb; 189(4):1459-63 [16963575]
TF
CovR [Q1J8D4, view regulon]
Reported TF sp.
Streptococcus pyogenes MGAS5005
Reported site sp.
Streptococcus pyogenes MGAS5005
Created by
Joe Sparenberg
Curation notes
-

Experimental Process

RNase protection assay used RNA from the wild type MGAS5005 and covR mutant strains showed that CovR represses rivR expression about threefold. Visual sequence inspection discovered a sequence ATTARA, which is consistent with all CovR binding sites. DNase I footprinting confirmed two CovR binding sites, both included the predicted sequence, on the rivR gene. In vitro transcription using GAS RNA polymerase and sigma factor showed that CovR alone represses rivR.

Transcription Factor Binding Sites


TATATAGGATTATACAATTTAAT
GAGAGAAAAATTACATTGTTAGATTATTATTTGGAA
TATATAGGATTATACAATTTAAT
GAGAGAAAAATTACATTGTTAGATTATTATTTGGAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TATATAGGATTATACAATTTAAT M5005_Spy_0186,
... ... M5005_Spy_0186 M5005_Spy_0187 M5005_Spy_0188 M5005_Spy_0189 M5005_Spy_0190 M5005_Spy_0191
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details In-vitro transcription (ECO:0001204) - Experimental technique details RNAse protection (ECO:0000288) - Experimental technique details Visual sequence inspection (nan) - repressor not specified
GAGAGAAAAATTACATTGTTAGATTATTATTTGGAA M5005_Spy_0186,
... ... M5005_Spy_0186 M5005_Spy_0187 M5005_Spy_0188 M5005_Spy_0189 M5005_Spy_0190 M5005_Spy_0191
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details In-vitro transcription (ECO:0001204) - Experimental technique details RNAse protection (ECO:0000288) - Experimental technique details Visual sequence inspection (nan) - repressor not specified