Based upon a previous study, an AT-rich palindromic sequence was identified in the operator site required for nickel-dependent regulation of the urease genes. EMSA of 102-bp oligonucleotide probes containing the palindromic sequence showed NikR bound them with specificity and in a nickel-dependent manner. For 60-bp probes with the palindrome flanked by 19-22 bases, binding was comparable to the larger probe. However, 43-bp probes with 12-base flanking regions showed reduced binding. DNAse I footprinting demonstrated NikR protected the palindrome sequence, and also showed protection of some DNAse cut sites 16 bases upstream.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TATAACACTAATTCATTTTAAATAATAATTAGTT |
|
activator | tetramer |