qPCR showed that mntH expression was repressed when cells were grown in high manganese media and this repression was abolished in low manganese media. qPCR analysis further showed that Fur represses mntH expression in the presence of manganese ions. EMSA confirmed that Fur directly regulates mntH. DNase I footprinting identified that Fur bound in the -56 to -22 region relative to the transcription start site of the mntH. The authors further report that the sequence bound by Fur in the mntH promoter contains three imperfect direct repeat hexamers. Mutations in the third hexamer abolished Fur binding.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GCCAGATGCAGTTGCAAATGAGTTGCAATAAGCTT | mntH, |
|
repressor | not specified |