Curation Information

Publication
NikR mediates nickel-responsive transcriptional repression of the Helicobacter pylori outer membrane proteins FecA3 (HP1400) and FrpB4 (HP1512).;Ernst FD, Stoof J, Horrevoets WM, Kuipers EJ, Kusters JG, van Vliet AH;Infection and immunity 2006 Dec; 74(12):6821-8 [17015456]
TF
NikR [O25896, view regulon]
Reported TF sp.
Helicobacter pylori 26695
Reported site sp.
Helicobacter pylori 26695
Created by
Grace Chandler
Curation notes
-

Experimental Process

Northern blotting experiments proved NikR represses transcription of FecA3 and FrpB4 genes. Quantitative phenotypic analysis of outer membrane protein production confirmed that this transcriptional repression leads to decreased expression. DNase I footprinting both validated binding of NikR to both promoters and localized the binding sites.

Transcription Factor Binding Sites


TATTATTAAATAGAATAATGTAATA
CATTATTAAGTTTTTTTTGTTTTTA
TATTATTAAATAGAATAATGTAATA
CATTATTAAGTTTTTTTTGTTTTTA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TATTATTAAATAGAATAATGTAATA HP1512
... ... HP1512
Experimental technique details Ad-hoc quantitative phenotype observation (ECO:0005676) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Northern blot (ECO:0005653) - repressor not specified
CATTATTAAGTTTTTTTTGTTTTTA HP1400
... ... HP1400
Experimental technique details Ad-hoc quantitative phenotype observation (ECO:0005676) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Northern blot (ECO:0005653) - repressor not specified