Curation Information

Publication
A novel DNA-binding site for the ferric uptake regulator (Fur) protein from Bradyrhizobium japonicum.;Friedman YE, O'Brian MR;The Journal of biological chemistry 2003 Oct 3; 278(40):38395-401 [12881516]
TF
Fur [H7C6Q1, view regulon]
Reported TF sp.
Bradyrhizobium diazoefficiens USDA 110
Reported site sp.
Bradyrhizobium diazoefficiens USDA 110
Created by
Grace Chandler
Curation notes
-

Experimental Process

EMSA was used to demonstrate Fur binding to the irr promoter. DNase I footprinting localized the Fur binding region in the irr promoter. In vitro transcription assays confirmed repression of irr expression by Fur.

Transcription Factor Binding Sites


GTTGCGAGAAACTTGCATCTGCATCTAT
GTTGCGAGAAACTTGCATCTGCATCTAT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type