Curation Information

Publication: In vitro analysis of protein-operator interactions of the NikR and fur metal-responsive regulators of coregulated genes in Helicobacter pylori.;Delany I, Ieva R, Soragni A, Hilleringmann M, Rappuoli R, Scarlato V;Journal of bacteriology 2005 Nov; 187(22):7703-15 [16267295]
TF: Fur [B5Z6G7, view regulon]
Reported TF sp.: Helicobacter pylori G27
Reported site sp.: Helicobacter pylori G27
Created by: Matthew Coveyou
Curation notes: -

Experimental Process

DNAse I footprinting identified two putative fur binding sites in the nikR-exbB intergenic region. DNAse I footprinting was also used to visualize competition assays between nikR and fur for these sites.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TAAATCCAGTTTGTATTATAATTGTTAATTTTA
TTGGATTTGATTGTAATTATTAGCTTAATCATTATT

TAAATCCAGTTTGTATTATAATTGTTAATTTTA
TTGAATTTGATTGTAATTATTAGCTTAATCATCATT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TAAATCCAGTTTGTATTATAATTGTTAATTTTA			Experimental technique details DNAse footprinting (ECO:0005631) DNAse footprinting - ECO:0005631 The DNAse foot-printing method starts by focusing on a given region of interest (e.g. a promoter region) and amplifying it by PCR to obtain lots of sample. It then throws in the TF and then the DNAse. The mix is left to stir for a short time and then gel electrophoresis is run to compare the pattern of fragments in a control (no TF) and in the sample. If the TF has bound the sample, it will have protected a stretch of DNA (encompassing some fragments of the control) and thus those fragments will not appear in the sample gel. The fragments can then be cut-out from the gel, purified and sequenced to obtain the sequence of the protected region. This is often used to identify the binding motif of a TF for the first time. The foot-printing will typically resolve the protected region down to 50-100 bp, and the sequence can be then examined for possible TF-binding sites either by eye of using a computer search. -	not specified	dimer
TTGAATTTGATTGTAATTATTAGCTTAATCATCATT			Experimental technique details DNAse footprinting (ECO:0005631) DNAse footprinting - ECO:0005631 The DNAse foot-printing method starts by focusing on a given region of interest (e.g. a promoter region) and amplifying it by PCR to obtain lots of sample. It then throws in the TF and then the DNAse. The mix is left to stir for a short time and then gel electrophoresis is run to compare the pattern of fragments in a control (no TF) and in the sample. If the TF has bound the sample, it will have protected a stretch of DNA (encompassing some fragments of the control) and thus those fragments will not appear in the sample gel. The fragments can then be cut-out from the gel, purified and sequenced to obtain the sequence of the protected region. This is often used to identify the binding motif of a TF for the first time. The foot-printing will typically resolve the protected region down to 50-100 bp, and the sequence can be then examined for possible TF-binding sites either by eye of using a computer search. -	not specified	dimer